Blog

Q.2 Disagree : Protest : : Agree : _______(By word meaning)(A) Refuse(B) Pretext(C) Recommend(D) Refute The correct answer is (C) Recommend.​ Analogy Explanation Disagree relates to Protest as a mild […]

Q.1 The village was nestled in a green spot, _______ the ocean and the hills.(A) through(B) in(C) at(D) between The correct answer is (D) between. This sentence from competitive exams […]

Q.103 Consider a healthy person with the following lung volumes:Residual volume = 900 mLExpiratory reserve volume = 800 mLTidal volume = 200 mLIf the Total lung capacity is 5500 mL, […]

Q.102 The pKa of a buffer solution with pH of 5, consisting of 0.4 M sodium acetate and0.04 M acetic acid, is ______. (Answer in integer) The pKa of the […]

Q.101 Consider the following nucleotide sequence:5′–GCCGCCAUGGCGUCUGCUAGCUGGCUCGAUCGCGAGCGAUCGUACGUAUAGUAUGAA–3′Assume canonical initiation, canonical termination, no post–translationalmodification, and the average molecular mass of an amino acid to be 110 daltons.The theoretical molecular mass of the […]

Q.100 Which one or more of the following parasites is/are typically transmitted bymosquitoes as vector?(A) Leishmania donovani(B) Plasmodium vivax(C) Wuchereria bancrofti(D) Trichuris trichiura Plasmodium vivax and Wuchereria bancrofti are typically […]

Q.99 The embryos of which one or more of the following animals show meroblasticcleavage?(A) Danio rerio (zebrafish)(B) Gallus gallus (chicken)(C) Synapta digita (sea cucumber)(D) Xenopus laevis (frog) Danio rerio (zebrafish) […]

Q.98 Consider a species of brightly colored beetle. Which one or more of the followingobservations suggest(s) that this species is aposematic?(A) Both male and female beetles are brightly colored.(B) Only […]

Q.97 Which one of the following rooted tree topologies best describes the primatephylogeny?(A) I(B) II(C) III(D) IV The best‐supported rooted tree topology for the given primate phylogeny is Option III.​​ Introduction […]

Q.96 When the blood glucose level of a healthy person is 100 mg/dL, which one of thefollowing options is most likely to represent the level of glucose in the urine […]