The Translation topic in the CSIR NET Life Science syllabus plays a pivotal role in understanding molecular biology. It covers the mechanisms by which mRNA is decoded to synthesize proteins — involving ribosomes, tRNA, and various factors essential for initiation, elongation, and termination.
One of the best ways to master this topic is by solving previous year CSIR NET questions. This article provides:
Detailed answer keys and explanations
Strategic insights on how to approach these questions
Translation is frequently asked in Part B and Part C of the CSIR NET exam. It often includes:
Mechanistic steps of translation in prokaryotes vs eukaryotes
Role of initiation factors (IFs), elongation factors (EFs), and release factors
Concepts like wobble base pairing, tRNA charging, Shine-Dalgarno sequence
Experimental questions (e.g., ribosome profiling, site-directed mutagenesis)
👉 [Download Link – PDF of Previous Year Questions on Translation with Solutions
Start with Nucleic Acid Structure: Ensure a strong grasp of mRNA, tRNA, and rRNA structures.
Learn Comparative Mechanisms: Understand the differences in translation between prokaryotes and eukaryotes.
Solve Conceptual PYQs: Focus on questions that test application, not just memorization.
Use Mnemonics: For initiation/elongation factors (like IF1, IF2, IF3, etc.)
Refer to Diagrams: Visualize steps using ribosome assembly and tRNA movement across A, P, and E sites.
Let’s Talk Academy (LTA), founded by Suraj Sir, is not just another coaching institute — it is a revolution in CSIR NET Life Science preparation. Here’s what sets it apart:
Suraj Sir is known for explaining even the most complex topics like Translation and Gene Expression through real-world analogies and experimental logic — which helps students retain better.
He focuses on experiments behind concepts — just like how translation was discovered and proven. This gives an edge in Part C questions which are often application-based.
Hundreds of students under Suraj Sir’s mentorship have cracked CSIR NET-JRF with top ranks. Many are now research fellows or PhD candidates in top institutes like IISc, IITs, and abroad.
Complete Strategy: Study + Practice + CBTs
🎓 Testimonial
“Translation always confused me — so many factors and steps! But under Suraj Sir, I finally understood it in a way that made it unforgettable. His ribosome assembly explanation was like a story. No one teaches like him.”
– Riya Mehra, CSIR NET JRF AIR-45
Final Tips
Focus more on mechanism-based questions in Translation
Always refer to PYQs to predict the exam trend
Use Let’s Talk Academy’s video lectures and notes for conceptual and visual clarity
Solving previous year questions on Translation is the best way to understand how CSIR NET tests your application of molecular biology. Pair it with expert guidance — and you’re unstoppable.
If you’re serious about cracking CSIR NET in Life Sciences, Let’s Talk Academy and Suraj Sir are names you can trust.
The sequence below represents part of the coding strand of the bacterial gene Z. The arrow indicates the transcription start site. |→ 5’TATAATCGCACTCAAAGCCTAAGGAGGATCCGAATGCACGC +1+10 .+20 GGAATCTTTCCGACCACTACTGCATAGCGCCCAGAGCTCGCT AAATCGAGCGTGACATAATCAC……….3’ The following statements […]
A ‘ nonsense’ mutation in the protein coding region of an upstream gene of a group of genes in an operon often leads to depletion of the downstream gene products. […]
The amino acid arginine is encoded by six codon: CGU, CGC, CGA, CGG, AGA, and AGG. Assuming inosine is not an option in the tRNA anticodon, what is the minimum […]
The polysome can be describes as (1) A special ribosome occurring in prokaryotes (2) A DNA strand which is being transcribed by may RNA polymerase(3) String of RNA occupied by […]
Given below is a partial coding sequence of a gene: 5′.AATGGACGCATGTGTCGATGG-3′ Which one of the following polypeptides CANNOT be produced by transcription and translation of the above DNA sequence in […]
Imagine the following RNA sequence is translated in the mammalian cytosol and mitochondria. RNA sequence: AUG AUA CUG UGA CUU AGG CUC UAA Following are some putative peptide sequences CytosolMitochondria […]
What would be the tripeptide produced by translation of the transcript produced by the following DNA sequence? 3’-AAGTACTCT-5’ (1) Arg-Phe-Trp (2) Arg – Leu – Gly (3) Thr- Lys —Ser […]
Which of the following statement is NOT regarding the genetic code? (1) one amino acid can have more then one codon (2) In eukaryotes the start codon is AUG (3) […]
A deletion of three consecutive bases in the coding region of a gene cannot result in (1) deletion of a single amino acid without any other change in the protein. […]
A synthetically prepared mRNA contains repetitive AU sequences. The mRNA was incubated with mammalian cell extract which contains ribosomes, tRNAs and all the factors required for protein synthesis. Assuming no […]
