Blog

Q.5 In the given diagram, ovals are marked at different heights (h) of a hill. Which oneof the following options P, Q, R, and S depicts the top view of […]

Q.4 Which one among the following statements must be TRUE about the mean and themedian of the scores of all candidates appearing for GATE 2023?(A) The median is at least […]

Q.3 A ‘frabjous’ number is defined as a 3 digit number with all digits odd, and no twoadjacent digits being the same. For example, 137 is a frabjous number, while […]

Q.2 Disagree : Protest : : Agree : _______(By word meaning)(A) Refuse(B) Pretext(C) Recommend(D) Refute The correct answer is (C) Recommend.​ Analogy Explanation Disagree relates to Protest as a mild […]

Q.1 The village was nestled in a green spot, _______ the ocean and the hills.(A) through(B) in(C) at(D) between The correct answer is (D) between. This sentence from competitive exams […]

Q.103 Consider a healthy person with the following lung volumes:Residual volume = 900 mLExpiratory reserve volume = 800 mLTidal volume = 200 mLIf the Total lung capacity is 5500 mL, […]

Q.102 The pKa of a buffer solution with pH of 5, consisting of 0.4 M sodium acetate and0.04 M acetic acid, is ______. (Answer in integer) The pKa of the […]

Q.101 Consider the following nucleotide sequence:5′–GCCGCCAUGGCGUCUGCUAGCUGGCUCGAUCGCGAGCGAUCGUACGUAUAGUAUGAA–3′Assume canonical initiation, canonical termination, no post–translationalmodification, and the average molecular mass of an amino acid to be 110 daltons.The theoretical molecular mass of the […]

Q.100 Which one or more of the following parasites is/are typically transmitted bymosquitoes as vector?(A) Leishmania donovani(B) Plasmodium vivax(C) Wuchereria bancrofti(D) Trichuris trichiura Plasmodium vivax and Wuchereria bancrofti are typically […]

Q.99 The embryos of which one or more of the following animals show meroblasticcleavage?(A) Danio rerio (zebrafish)(B) Gallus gallus (chicken)(C) Synapta digita (sea cucumber)(D) Xenopus laevis (frog) Danio rerio (zebrafish) […]