The sequence of first strand of DNA obtained after reverse transcription of a bacterial mRNA is the same as: (1) Anti-sense DNA strand (2) Sense DNA strand (3) mRNA (4) […]
Tag: dbt jrf pyq
No posts found.
DBT BET JRF 2021 Previous Year Questions and Video solution
Impact of 4-Letter Codons on Protein Translation: How Many Amino Acids Could Be Recognized?
If the codons for translation of mRNAs to proteins were 4 letters long instead of 3what would be the maximum number of hypothetical amino acids that could uniquely be recognized […]
DBT BET JRF 2020 Previous Year Questions and Video solutions
Who Is Good in Biology, Cricket, Chemistry, and Football? A Logical Breakdown
Keshav and Kunal are good in Maths and Chemistry. Sumit and Keshav are good in Maths and Biology. Vineet and Kunal are good in Cricket and Chemistry. Sumit, Vineet and […]
DBT BET JRF 2019 Previous Year Questions and Video solution
How to Reduce Competitive Inhibition of Enzymes
Competitive inhibition of an enzyme can be reduced by: (1) Reducing the amount of the substrate (2)Increasing the amount of the substrate (3) Decreasing the amount of the enzyme (4) […]
DBT BET JRF 2021 Previous Year Questions and Video solution
Understanding Differential Gene Expression Analysis: Which Method is Not Suitable?
19. Which one of the following CANNOT be used for differential gene expression analysis? (a) EST data analysis (b) Microarray data analysis (c) mRNA sequencing data analysis (d) Whole genome […]
DBT BET JRF 2019 Previous Year Questions and Video solution
Identifying Phosphorylation Sites in Peptide Sequences
A peptide of sequence -SHELR- is isolated from bacteria. Which one of the following options lists the possible phosphorylation site in this peptide? (1) H (2) L (3) R (4) […]
DBT BET JRF 2021 Previous Year Questions and Video solution
Isomerization Redox Group Transfer, and Hydrolysis Reactions
18. Match the components of list I with those in list II. List I […]
DBT BET JRF 2020 Previous Year Questions and Video solutions
Why Did a Tree Species Go Extinct After the Dodo? The Surprising Role of Seed Dispersal
The fruit of a particular tree species formed the predominant diet of the dodo. After dodo became extinct, that tree species also became extinct. Which of the following is the […]
DBT BET JRF 2019 Previous Year Questions and Video solution
Which dsDNA Sequence Has the Highest Melting Temperature
Of the dsDNA sequences given below, the sequence that is expected to have a higher melting temperature is: (1) ATGACATTATTACATTAGTG (2) GCGCGTGCATGCCCGATGCC (3) ATTATTATACGTATTTATAT (4) CGCGATCGGGGATTACGAGC Which dsDNA Sequence Has […]
DBT BET JRF 2019 Previous Year Questions and Video solution
How Radioactive Sulfur Incorporation Affects Tetra-Peptides in Bacterial Cultures
A bacterial culture grown in a medium containing radioactive sulphur would incorporate the radiolabel in the tetra-peptide: (1) serine-cysteine-tyrosine-methionine. (2) threonine-lysine-aspartic acid-glutamic acid. (3) alanine-proline-histidine-glycine. (4) tryptophan-phenylalanine-valine-isoleucine How Radioactive Sulfur […]
