Ciprofloxacin is a synthetic chemotherapeutic antibiotic of the fluoroquinolone drug class. The target of antibiotic ciprofloxacin is (1) Replication (2) Protein synthesis (3) Cell wall synthesis (4) Membrane structure […]
Tag: csir pyq molecular biology
csir pyq molecular biology
No posts found.
CSIR NET Life Science Previous Year Questions and Solution on DNA REPLICATION
How Incorporating Telomere Sequences Restores Stability of Linear Plasmids in Yeast
When circular plasmids having a centromere sequence are transformed into yeast cells, they replicate and segregate in each cell division. However, if a linear chromosome is generated by cutting the […]
CSIR NET Life Science Previous Year Questions and Solution on DNA REPLICATION
Telomeres: Protecting Chromosome Ends and Maintaining Genome Integrity
The following statements are made about telomeres: A. proteins (TBPs) are believed to shield telomeres from the cell’s DNA repair machinery, preventing them from being recognized as double-strand breaks, B. […]
CSIR NET Life Science Previous Year Questions and Solution on DNA REPLICATION
Which Statement Does NOT Characterize Aging? Insights into Insulin/IGF-1 Signaling, Telomeres, and Lifespan
Which one of the following does NOT characterize aging? (I) An insulin/IGF-I signaling system plays an important role in controlling lifespan. (2) Lifespan increases due to resistance to oxidative stress. […]
CSIR NET Life Science Previous Year Questions and Solution on DNA REPLICATION
Telomerase Activity: Key to Telomere Elongation, Aging, and Cancer Immortality
Which statement is correct in relation of activity of telomerase? (1) Increase with age (2) Observed in all cancers and responsible for immortality (3) Responsible for apoptosis but not for […]
CSIR NET Life Science Previous Year Questions and Solution on DNA REPLICATION
Understanding Why Telomerase RNA Knockout Mice Cells Proliferate Longer Than Human Cells
In order to study the role of telomeres in DNA replication, genetically engineered mice were prepared, where the gene for telomerase RNA was knocked out. When cells from these knock […]
CSIR NET Life Science Previous Year Questions and Solution on DNA REPLICATION
Telomerase: The Specialized RNA-Dependent DNA Polymerase That Maintains Chromosome Ends
70 Telomerase, a RNA-protein complex which completes the replication of telomeres during DNA synthesis, is a specialized (1) RNA dependent DNA polymerase (2) DNA dependent DNA polymerase (3) DNA dependent […]
CSIR NET Life Science Previous Year Questions and Solution on DNA REPLICATION
Telomerase: The Key Enzyme Synthesizing DNA at Chromosome Ends to Preserve Genome Integrity
69, The function of telomerase is (1) Synthesis of DNA at ends of chromosome (2) Synthesis at RNA primers (3) Replication of normal DNA (4) Reverse transcriptase of causing cancer […]
CSIR NET Life Science Previous Year Questions and Solution on Molecular Biology
Understanding the Polar Effect of Nonsense Mutations in Bacterial Operons and the Role of Suppressor tRNAs
The sequence below represents part of the coding strand of the bacterial gene Z. The arrow indicates the transcription start site. |→ 5’TATAATCGCACTCAAAGCCTAAGGAGGATCCGAATGCACGC +1+10 .+20 GGAATCTTTCCGACCACTACTGCATAGCGCCCAGAGCTCGCT AAATCGAGCGTGACATAATCAC……….3’ The following statements […]
CSIR NET Life Science Previous Year Questions and Solution on Molecular Biology
Understanding the Polar Effect of Nonsense Mutations in Operons: Role of Rho and Suppressor tRNAs
A ‘ nonsense’ mutation in the protein coding region of an upstream gene of a group of genes in an operon often leads to depletion of the downstream gene products. […]
