Q.101 Consider the following nucleotide sequence: 5′-GCCGCCAUGGCGUCUGCUAGCUGGCUCGAUCGCGAGCGAUCGUAC GUAUAGUAUGAA-3′ Assume canonical initiation, canonical termination, no post-translational modification, and the average molecular mass of an amino acid to be 110 daltons. The theoretical molecular mass of the polypeptide translated from the above nucleotide sequence is _____ daltons. (Answer in integer)

Q.101 Consider the following nucleotide sequence:
5GCCGCCAUGGCGUCUGCUAGCUGGCUCGAUCGCGAGCGAUCGUAC
GUAUAGUAUGAA3′

Assume canonical initiation, canonical termination, no posttranslational
modification, and the average molecular mass of an amino acid to be 110 daltons.
The theoretical molecular mass of the polypeptide translated from the above
nucleotide sequence is _____ daltons. (Answer in integer)

The theoretical molecular mass of the polypeptide is 1540 daltons.

Sequence Analysis

The given nucleotide sequence is 5′-GCCGCCAUGGCGUCUGCUAGCUGGCUCGAUCGCGAGCGAUCGUACGUAUAGUAUGAA-3′, a 57-nucleotide mRNA with canonical initiation at AUG and termination at UAA, UAG, or UGA. Translation starts at the first AUG (positions 7-9, 0-based index 6), yielding the coding sequence AUGGCGUCUGCUAGCUGGCUCGAUCGCGAGCGAUCGUACGU (51 nucleotides). A UAG stop codon appears at codons 15-17, so translation includes 14 codons before termination.

Codon Translation

Reading in triplets from AUG:

  • AUG (Met), GCG (Ala), UCU (Ser), GCU (Ala), AGC (Ser), UGG (Trp), CUC (Leu), GAU (Asp), CGC (Arg), GAG (Glu), CGA (Arg), UCG (Ser), UAC (Tyr), GUA (Val), UAG (stop).
    The polypeptide comprises 14 amino acids (Met-Ala-Ser-Ala-Ser-Trp-Leu-Asp-Arg-Glu-Arg-Ser-Tyr-Val); stop codons do not encode residues. No post-translational modifications apply per the query.

Mass Calculation

Using the average amino acid mass of 110 daltons, the mass is 14×110=1540 daltons. This approximates residue masses in polypeptides, excluding water loss from peptide bonds, as specified.​theoretical molecular mass of polypeptide from nucleotide sequence

Introduction: Theoretical Molecular Mass of Polypeptide from Nucleotide Sequence

In CSIR NET Life Sciences preparation, mastering theoretical molecular mass of polypeptide from nucleotide sequence is crucial for molecular biology and genetic code questions. This guide solves a key practice problem with canonical initiation (AUG), termination (UAA/UAG/UGA), and 110 daltons average amino acid mass, yielding 1540 daltons—ideal for exam readiness.

Step-by-Step Translation Process

Identify the start codon AUG at position 7 in the 57-nucleotide mRNA sequence. Extract 51-nucleotide coding region ending at UAG stop codon (codon 15), translating 14 codons into Met-Ala-Ser-Ala-Ser-Trp-Leu-Asp-Arg-Glu-Arg-Ser-Tyr-Val. Stop codons halt synthesis without adding mass.

Genetic Code Reference

Use standard genetic code table: AUG (Met, initiation), GCG (Ala), UCU/GCU/AGC/UCG (Ser), UGG (Trp), etc.. Canonical rules ensure frame accuracy from 5′ to 3′.

Mass Computation Formula

Polypeptide mass = (number of amino acids) × 110 Da. Here, 14 residues × 110 = 1540 daltons, ignoring N/C-terminal adjustments per problem constraints.

CSIR NET Exam Tips

Practice scanning for AUG/UAG in sequences; count codons excluding stop. Verify with Python/tools for precision. Common pitfalls: overlooking frame or including stops.

1 Comment
  • Bhanwar
    February 1, 2026

    1540 daltons

Leave a Reply

Your email address will not be published. Required fields are marked *

Latest Courses