Tag: dbt jrf 2019

The sequence of first strand of DNA obtained after reverse transcription of a bacterial mRNA is the same as: (1) Anti-sense DNA strand (2) Sense DNA strand (3) mRNA (4) […]

Competitive inhibition of an enzyme can be reduced by: (1) Reducing the amount of the substrate (2)Increasing the amount of the substrate (3) Decreasing the amount of the enzyme (4) […]

A peptide of sequence -SHELR- is isolated from bacteria. Which one of the following options lists the possible phosphorylation site in this peptide? (1) H (2) L (3) R (4) […]

Of the dsDNA sequences given below, the sequence that is expected to have a higher melting temperature is: (1) ATGACATTATTACATTAGTG (2) GCGCGTGCATGCCCGATGCC (3) ATTATTATACGTATTTATAT (4) CGCGATCGGGGATTACGAGC Which dsDNA Sequence Has […]

A bacterial culture grown in a medium containing radioactive sulphur would incorporate the radiolabel in the tetra-peptide: (1) serine-cysteine-tyrosine-methionine. (2) threonine-lysine-aspartic acid-glutamic acid. (3) alanine-proline-histidine-glycine. (4) tryptophan-phenylalanine-valine-isoleucine How Radioactive Sulfur […]

Allele ‘A’ is dominant over allele ‘a’ and results in dark skin pigmentation. In a mating of Aa with Aa, if 6 offspring are produced, the probability of all having […]

Which one of the following statements about alleles is NOT TRUE? (1) They may occupy different loci in the same chromosome (2) There may be several at one locus (3) […]

Which one of the following statements is NOT TRUE for an enhancer element? (1) it can be downstream of the gene it regulates (2) it can only regulate a nearby […]

A patient suffering from allergy has been advised to take anti-histamine drugs. Which one of the following biological processes is most likely to be the reason for the allergy? (1) […]