74. The following represents sequences of different alleles of a gene found in family represented by mother, (allele1/ allele2), father (allele1/allele 2) and their two sons: Son1 (allele1/allele 2) and Son 2 (allele1/allele2). Further, a new mutation was observed in one of the alleles of the son, which is marked with a triangle. Mother allele 1 CAGCATAGTCATTCGTCCATGGACTAG Mother allele 2 CAGCATTCTCAUCGTCCATGGACTAG Father allele 1 CAGCATTGTCATTCGTCCATGGGCTAG Father allele 1 CAGCTTAGTCATTCGTCCATGGTACTAG Son 1 allel 1 CAGCATAGTC.ATTCGTCCATGGACTAG Son 1 allele2 CAGCTTACTCATTCCTCCATTGTACTAG Son 2 allele 1 CAGCATTGTCATTCGTCCATGGACTAG Son 2 allele 2 CAGCTTAGTCATTCGTCCATTGTACTAG The following statements were made about the mutation: A. The mutation arose in the germline of the father. B. The mutation arose in the son. C. The given DNA sequences are present on the X chromosome. D. There is a possibility to use RFLP for tracking this variation. Which one of the following options presents a combination of correct statements? (1) B only (2) A and D (3) A and C (4) B and D
  1. The following represents sequences of different alleles of a gene found in family represented by mother, (allele1/ allele2), father (allele1/allele 2) and their two sons: Son1 (allele1/allele 2) and Son 2 (allele1/allele2). Further, a new mutation was observed in one of the alleles of the son, which is marked with a triangle.
    Mother allele 1 CAGCATAGTCATTCGTCCATGGACTAG
    Mother allele 2 CAGCATTCTCAUCGTCCATGGACTAG
    Father allele 1 CAGCATTGTCATTCGTCCATGGGCTAG
    Father allele 1 CAGCTTAGTCATTCGTCCATGGTACTAG
    Son 1 allel 1 CAGCATAGTC.ATTCGTCCATGGACTAG
    Son 1 allele2 CAGCTTACTCATTCCTCCATTGTACTAG

    Son 2 allele 1 CAGCATTGTCATTCGTCCATGGACTAG
    Son 2 allele 2 CAGCTTAGTCATTCGTCCATTGTACTAG

The following statements were made about the mutation:
A. The mutation arose in the germline of the father.
B. The mutation arose in the son.
C. The given DNA sequences are present on the X chromosome.
D. There is a possibility to use RFLP for tracking this variation.
Which one of the following options presents a combination of correct statements?
(1) B only          (2) A and D
(3) A and C      (4) B and D

Introduction:
This question tests concepts of germline versus somatic mutation, inheritance of alleles from parents to offspring, X‑linked localization of a gene using pedigree information, and the application of RFLP to track sequence variation in a family. A careful comparison of the given allelic DNA sequences in mother, father and two sons helps identify in whom the mutation arose and how the variation can be followed experimentally in genetics problems.

Note: As the exact bases at the triangle positions are graphical and not fully machine‑readable here, the logic below follows the standard solution pattern used for this CSIR‑NET style family DNA‑sequence question.

Stepwise analysis of the sequence data:

  • Mother has two distinct alleles (allele 1 and allele 2).

  • Father also has two distinct alleles (allele 1 and allele 2).

  • Each son carries one allele inherited from the mother and one from the father (biparental combination).

  • One allele in one son shows a new base change compared with the corresponding parental allele and is marked with a triangle, indicating a de novo mutation in that allele.

From the standard solution to this question, the new mutation is seen in a son’s allele that otherwise matches the paternal allele, meaning it is a fresh change on the paternal copy in the child, not present in the father’s somatic DNA sequence set given in the question. This means the mutation appeared in a germ cell of the father just before fertilization or very early after zygote formation in that son.

Explanation of each statement:

A. “The mutation arose in the germline of the father.”

  • The mutant allele in the son is identical to one of the father’s alleles except at the single altered base marked by the triangle.

  • The father’s listed alleles do not show this change, meaning his somatic genotype at that locus is non‑mutant.

  • Therefore, the most consistent explanation is that one of the father’s germ cells (sperm) accumulated this new mutation, which was then transmitted to the son as a de novo paternal germline mutation.

  • Hence, statement A is correct.

B. “The mutation arose in the son.”

  • For a mutation to be said to have arisen in the son (somatic mutation), it would have to occur after zygote formation, leading to mosaicism, or be present only in somatic tissues.

  • However, the question treats the son’s allele as a stable germline allele comparable to parental alleles (and used for inheritance analysis), which implies that the mutation is present in his germline genotype, not a later somatic event.

  • Moreover, the pattern given in the official solution for this standard question attributes the first appearance of the altered base to a paternal germ cell, not to a post‑zygotic event.

  • Thus, statement B is considered incorrect in the exam context.

C. “The given DNA sequences are present on the X chromosome.”

  • Both offspring shown are sons. Each son must receive his single X chromosome from the mother and his Y chromosome from the father.

  • If the gene were on the X chromosome, both sons should have exactly the same maternal allele (because they each receive only one X – their mother’s X allele transmitted to them) and should not be heterozygous for an X‑linked locus.

  • The data show each son with two alleles (allele 1 and allele 2), indicating a typical autosomal locus, not an X‑linked one.

  • Therefore, statement C is incorrect.

D. “There is a possibility to use RFLP for tracking this variation.”

  • The observed mutation is a single base change (point mutation) that distinguishes the mutant allele from the normal parental allele.

  • If this base change either creates or abolishes a restriction endonuclease recognition site, then restriction fragment length polymorphism (RFLP) can be used to track this variant in the family.

  • In classical genetics exam questions, a single nucleotide change that can be followed in a pedigree is commonly assumed to be suitable for RFLP analysis, unless stated otherwise.

  • Hence, statement D is considered correct in the context of the question.

Evaluating the options:

  • A: Correct (mutation arose in a paternal germ cell forming the son’s mutant allele).

  • B: Incorrect (not treated as a purely somatic mutation in the son).

  • C: Incorrect (inheritance pattern indicates an autosomal, not X‑linked, locus).

  • D: Correct (point mutation can be tracked as an RFLP if it alters a restriction site).

Given answer choices:

  1. B only

  2. A and D

  3. A and C

  4. B and D

The correct combination of statements is: A and D.

Therefore, the correct option is: (2) A and D.

Leave a Reply

Your email address will not be published. Required fields are marked *

Latest Courses