No posts found.
The sequence below represents part of the coding strand of the bacterial gene Z. The arrow indicates the transcription start site. |→ 5’TATAATCGCACTCAAAGCCTAAGGAGGATCCGAATGCACGC +1+10 .+20 GGAATCTTTCCGACCACTACTGCATAGCGCCCAGAGCTCGCT AAATCGAGCGTGACATAATCAC……….3’ The following statements […]
A ‘ nonsense’ mutation in the protein coding region of an upstream gene of a group of genes in an operon often leads to depletion of the downstream gene products. […]
The amino acid arginine is encoded by six codon: CGU, CGC, CGA, CGG, AGA, and AGG. Assuming inosine is not an option in the tRNA anticodon, what is the minimum […]
The polysome can be describes as (1) A special ribosome occurring in prokaryotes (2) A DNA strand which is being transcribed by may RNA polymerase(3) String of RNA occupied by […]
Given below is a partial coding sequence of a gene: 5′.AATGGACGCATGTGTCGATGG-3′ Which one of the following polypeptides CANNOT be produced by transcription and translation of the above DNA sequence in […]
Imagine the following RNA sequence is translated in the mammalian cytosol and mitochondria. RNA sequence: AUG AUA CUG UGA CUU AGG CUC UAA Following are some putative peptide sequences CytosolMitochondria […]
What would be the tripeptide produced by translation of the transcript produced by the following DNA sequence? 3’-AAGTACTCT-5’ (1) Arg-Phe-Trp (2) Arg – Leu – Gly (3) Thr- Lys —Ser […]
Which of the following statement is NOT regarding the genetic code? (1) one amino acid can have more then one codon (2) In eukaryotes the start codon is AUG (3) […]
A deletion of three consecutive bases in the coding region of a gene cannot result in (1) deletion of a single amino acid without any other change in the protein. […]
A synthetically prepared mRNA contains repetitive AU sequences. The mRNA was incubated with mammalian cell extract which contains ribosomes, tRNAs and all the factors required for protein synthesis. Assuming no […]
