Of the dsDNA sequences given below, the sequence that is expected to have a higher melting temperature
is:
(1) ATGACATTATTACATTAGTG
(2) GCGCGTGCATGCCCGATGCC
(3) ATTATTATACGTATTTATAT
(4) CGCGATCGGGGATTACGAGC

Which dsDNA Sequence Has the Highest Melting Temperature

When studying DNA, understanding the melting temperature (Tm) of double-stranded DNA (dsDNA) is crucial. The Tm refers to the temperature at which half of the DNA molecules are denatured (i.e., the strands separate from each other). The melting temperature of DNA depends on several factors, including the GC content and the length of the DNA sequence.

The question at hand is:
Which of the following dsDNA sequences is expected to have a higher melting temperature?

1. ATGACATTATTACATTAGTG

2. GCGCGTGCATGCCCGATGCC

3. ATTATTATACGTATTTATAT

4. CGCGATCGGGGATTACGAGC

Key Factors Affecting DNA Melting Temperature

The melting temperature is influenced by two main factors:

1. GC Content:

   • Guanine (G) and Cytosine (C) pairs form three hydrogen bonds compared to the two hydrogen bonds between Adenine (A) and Thymine (T). As a result, GC-rich sequences are more stable and require higher temperatures to denature compared to AT-rich sequences.

   • Higher GC content increases the Tm.

2. Length of the DNA Strand:

   • Longer DNA sequences generally have a higher Tm, as there are more base pairs holding the two strands together.

Now, let’s analyze each of the given dsDNA sequences and predict which one will have the highest melting temperature.

Analyzing the DNA Sequences

1. ATGACATTATTACATTAGTG

• This sequence is relatively AT-rich, containing many A and T bases.

• Since A-T pairs only form two hydrogen bonds, this sequence is less stable than a GC-rich sequence, meaning it will have a lower melting temperature compared to other sequences.

2. GCGCGTGCATGCCCGATGCC

• This sequence has a higher proportion of G-C pairs than the previous one, indicating a higher GC content.

• The presence of multiple G-C pairs, which form three hydrogen bonds, makes this sequence more stable and likely to have a higher melting temperature than the AT-rich sequence.

3. ATTATTATACGTATTTATAT

• This sequence also has many A-T pairs and fewer G-C pairs.

• Similar to the first sequence, the AT-rich composition suggests that this sequence will have a lower melting temperature due to the reduced stability of A-T pairs.

4. CGCGATCGGGGATTACGAGC

• This sequence is GC-rich, containing several G-C pairs throughout.

• The high GC content (which stabilizes the DNA due to three hydrogen bonds) makes this sequence the most likely to have the highest melting temperature among the four options.

Conclusion

Based on the analysis of GC content and the number of hydrogen bonds between base pairs, the sequence with the highest melting temperature is:

• (4) CGCGATCGGGGATTACGAGC

This sequence has the highest proportion of G-C pairs, which stabilize the DNA and increase the melting temperature.

Summary Table of Sequence Analysis

Final Thoughts

When studying the melting temperature of DNA, the GC content is the most critical factor. Sequences with higher GC content tend to have a higher melting temperature because G-C pairs form stronger bonds than A-T pairs. Therefore, in this case, the CGCGATCGGGGATTACGAGC sequence will have the highest Tm, making it more stable and requiring a higher temperature to denature compared to the other sequences.

Understanding how DNA melting temperature is affected by base composition is essential for many areas of molecular biology, such as PCR, DNA hybridization, and other genomic studies.